Incidência da doença de petri na videira ‘niagara rosada’ no estado de São Paulo - Brasil
Main Author: | |
---|---|
Publication Date: | 2017 |
Other Authors: | , , , |
Format: | Article |
Language: | por |
Source: | Repositório Institucional da UNESP |
Download full: | http://dx.doi.org/10.1590/0100-5405/2154 http://hdl.handle.net/11449/179013 |
Summary: | The Petri disease caused mainly by Phaeomoniella chlamydospora and species of Phaeoacremonium is serious, complex, attacks young vine plants and is difficult to be controlled worldwide. In Brazil, São Paulo State is among the largest producers of ‘Niagara Rosada’ grapevine, and there is no official report of this disease in the state. Thus, the aims of the present study were to evaluate the incidence of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State and to compare methodologies to isolate the causal agents of this disease. Experimental design was completely randomized, testing three culture media (water-agar [WA], potato dextrose agar [PDA] and apple-green bait) with samples of diseased plants, disinfested or not, from nine sampling locality and eight replicates (Petri dish with the media and four fragments of the plants per sample). The number of colonies of causal agents per fragment per dish of each culture medium per locality was determined. Fungal isolates obtained by DNA extraction and sequencing of ITS-5.8S rDNA region [ITS1 TCCGTAGGTGAACCTGCGG and ITS4 TCCTCCGCTTATTGATATGC] and parts of the alpha elongase genes [EF1 ATGGGTAAGGARGACAAGAC and EF2 GGARGTACCAGTSATCATGTT] and beta tubulin genes [Bt2a GGTAACCAAATCGGTGCTGCTTTC and Bt2b ACCCTCAGTGTAGTGACCCTTGGC] were identified. Pathogenicity test was done with one isolate of Phaeomoniella spp. and one isolate of Phaeoacremonium spp. The disease incidence and severity (length of dark streaks in the vascular system) were evaluated. The municipalities Louveira B, Vinhedo, Jundiaí, Jarinu, Porto Feliz, Sao Miguel Arcanjo and Jales were the localities where the causal agents of the disease were present, demonstrating that the Petri disease occurs throughout São Paulo State. The most prevalent species of Phaeoacremonium was P. minimum (= P. aleophilum). Besides P. minimum, the species P. venezuelense was detected only in the municipality of Jales. P. chlamydospora was the only species identified within this genus. Isolation percentage was higher for P. chlamydospora than for Phaeoacremonium spp. The causal agents of the disease must be isolated by removing fragments of the vascular system from the collar region of symptomatic plants, followed by surface disinfection and plating of fragments in PDA culture medium. Incubation in BOD should be at 23ºC for up to 21 days. The apple-green bait method followed by culturing in PDA did not allow isolation of any of the causal agents of the disease. All inoculated plants developed external symptoms and internally the average length of dark streaks was 7.9 cm for P. chlamydospora and 5.2 cm for P. minimum. Control plants remained healthy. Fungi were re-isolated from diseased plants, completing the Koch’s postulates, thus making official the record of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State, Brazil. |
id |
UNSP_fb31a36c2af5ea8723c6e6104918ab8a |
---|---|
oai_identifier_str |
oai:repositorio.unesp.br:11449/179013 |
network_acronym_str |
UNSP |
network_name_str |
Repositório Institucional da UNESP |
repository_id_str |
2946 |
spelling |
Incidência da doença de petri na videira ‘niagara rosada’ no estado de São Paulo - BrasilIncidence of petri disease in ‘niagara rosada’ grapevine in São Paulo state - BrazilDeclinePhaeoacremonium aleophiliumPhaeoacremonium minimumPhaeomoniella chlamydosporaThe Petri disease caused mainly by Phaeomoniella chlamydospora and species of Phaeoacremonium is serious, complex, attacks young vine plants and is difficult to be controlled worldwide. In Brazil, São Paulo State is among the largest producers of ‘Niagara Rosada’ grapevine, and there is no official report of this disease in the state. Thus, the aims of the present study were to evaluate the incidence of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State and to compare methodologies to isolate the causal agents of this disease. Experimental design was completely randomized, testing three culture media (water-agar [WA], potato dextrose agar [PDA] and apple-green bait) with samples of diseased plants, disinfested or not, from nine sampling locality and eight replicates (Petri dish with the media and four fragments of the plants per sample). The number of colonies of causal agents per fragment per dish of each culture medium per locality was determined. Fungal isolates obtained by DNA extraction and sequencing of ITS-5.8S rDNA region [ITS1 TCCGTAGGTGAACCTGCGG and ITS4 TCCTCCGCTTATTGATATGC] and parts of the alpha elongase genes [EF1 ATGGGTAAGGARGACAAGAC and EF2 GGARGTACCAGTSATCATGTT] and beta tubulin genes [Bt2a GGTAACCAAATCGGTGCTGCTTTC and Bt2b ACCCTCAGTGTAGTGACCCTTGGC] were identified. Pathogenicity test was done with one isolate of Phaeomoniella spp. and one isolate of Phaeoacremonium spp. The disease incidence and severity (length of dark streaks in the vascular system) were evaluated. The municipalities Louveira B, Vinhedo, Jundiaí, Jarinu, Porto Feliz, Sao Miguel Arcanjo and Jales were the localities where the causal agents of the disease were present, demonstrating that the Petri disease occurs throughout São Paulo State. The most prevalent species of Phaeoacremonium was P. minimum (= P. aleophilum). Besides P. minimum, the species P. venezuelense was detected only in the municipality of Jales. P. chlamydospora was the only species identified within this genus. Isolation percentage was higher for P. chlamydospora than for Phaeoacremonium spp. The causal agents of the disease must be isolated by removing fragments of the vascular system from the collar region of symptomatic plants, followed by surface disinfection and plating of fragments in PDA culture medium. Incubation in BOD should be at 23ºC for up to 21 days. The apple-green bait method followed by culturing in PDA did not allow isolation of any of the causal agents of the disease. All inoculated plants developed external symptoms and internally the average length of dark streaks was 7.9 cm for P. chlamydospora and 5.2 cm for P. minimum. Control plants remained healthy. Fungi were re-isolated from diseased plants, completing the Koch’s postulates, thus making official the record of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State, Brazil.Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)Instituto Biológico APTA, Alameda dos Vidoeiros, n. 1097, Bairro GramadoBolsista CAPES (Parte da dissertação de mestrado), Avenida Conselheiro Rodrigues Alves, 1252Instituto Biológico APTA, Avenida Conselheiro Rodrigues Alves, 1252Instituto de Biociências UNESPInstituto de Biociências UNESPAPTABolsista CAPES (Parte da dissertação de mestrado)Universidade Estadual Paulista (Unesp)Ferreira, Ana Beatriz MonteiroLeite, Luís GarrigósHarakava, RicardoPadovani, Carlos Roberto [UNESP]Bueno, César Júnior2018-12-11T17:33:08Z2018-12-11T17:33:08Z2017-04-01info:eu-repo/semantics/publishedVersioninfo:eu-repo/semantics/article124-131application/pdfhttp://dx.doi.org/10.1590/0100-5405/2154Summa Phytopathologica, v. 43, n. 2, p. 124-131, 2017.0100-5405http://hdl.handle.net/11449/17901310.1590/0100-5405/2154S0100-540520170002001242-s2.0-85022098680S0100-54052017000200124.pdfScopusreponame:Repositório Institucional da UNESPinstname:Universidade Estadual Paulista (UNESP)instacron:UNESPporSumma Phytopathologica0,258info:eu-repo/semantics/openAccess2024-01-11T06:26:31Zoai:repositorio.unesp.br:11449/179013Repositório InstitucionalPUBhttp://repositorio.unesp.br/oai/requestopendoar:29462024-01-11T06:26:31Repositório Institucional da UNESP - Universidade Estadual Paulista (UNESP)false |
dc.title.none.fl_str_mv |
Incidência da doença de petri na videira ‘niagara rosada’ no estado de São Paulo - Brasil Incidence of petri disease in ‘niagara rosada’ grapevine in São Paulo state - Brazil |
title |
Incidência da doença de petri na videira ‘niagara rosada’ no estado de São Paulo - Brasil |
spellingShingle |
Incidência da doença de petri na videira ‘niagara rosada’ no estado de São Paulo - Brasil Ferreira, Ana Beatriz Monteiro Decline Phaeoacremonium aleophilium Phaeoacremonium minimum Phaeomoniella chlamydospora |
title_short |
Incidência da doença de petri na videira ‘niagara rosada’ no estado de São Paulo - Brasil |
title_full |
Incidência da doença de petri na videira ‘niagara rosada’ no estado de São Paulo - Brasil |
title_fullStr |
Incidência da doença de petri na videira ‘niagara rosada’ no estado de São Paulo - Brasil |
title_full_unstemmed |
Incidência da doença de petri na videira ‘niagara rosada’ no estado de São Paulo - Brasil |
title_sort |
Incidência da doença de petri na videira ‘niagara rosada’ no estado de São Paulo - Brasil |
author |
Ferreira, Ana Beatriz Monteiro |
author_facet |
Ferreira, Ana Beatriz Monteiro Leite, Luís Garrigós Harakava, Ricardo Padovani, Carlos Roberto [UNESP] Bueno, César Júnior |
author_role |
author |
author2 |
Leite, Luís Garrigós Harakava, Ricardo Padovani, Carlos Roberto [UNESP] Bueno, César Júnior |
author2_role |
author author author author |
dc.contributor.none.fl_str_mv |
APTA Bolsista CAPES (Parte da dissertação de mestrado) Universidade Estadual Paulista (Unesp) |
dc.contributor.author.fl_str_mv |
Ferreira, Ana Beatriz Monteiro Leite, Luís Garrigós Harakava, Ricardo Padovani, Carlos Roberto [UNESP] Bueno, César Júnior |
dc.subject.por.fl_str_mv |
Decline Phaeoacremonium aleophilium Phaeoacremonium minimum Phaeomoniella chlamydospora |
topic |
Decline Phaeoacremonium aleophilium Phaeoacremonium minimum Phaeomoniella chlamydospora |
description |
The Petri disease caused mainly by Phaeomoniella chlamydospora and species of Phaeoacremonium is serious, complex, attacks young vine plants and is difficult to be controlled worldwide. In Brazil, São Paulo State is among the largest producers of ‘Niagara Rosada’ grapevine, and there is no official report of this disease in the state. Thus, the aims of the present study were to evaluate the incidence of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State and to compare methodologies to isolate the causal agents of this disease. Experimental design was completely randomized, testing three culture media (water-agar [WA], potato dextrose agar [PDA] and apple-green bait) with samples of diseased plants, disinfested or not, from nine sampling locality and eight replicates (Petri dish with the media and four fragments of the plants per sample). The number of colonies of causal agents per fragment per dish of each culture medium per locality was determined. Fungal isolates obtained by DNA extraction and sequencing of ITS-5.8S rDNA region [ITS1 TCCGTAGGTGAACCTGCGG and ITS4 TCCTCCGCTTATTGATATGC] and parts of the alpha elongase genes [EF1 ATGGGTAAGGARGACAAGAC and EF2 GGARGTACCAGTSATCATGTT] and beta tubulin genes [Bt2a GGTAACCAAATCGGTGCTGCTTTC and Bt2b ACCCTCAGTGTAGTGACCCTTGGC] were identified. Pathogenicity test was done with one isolate of Phaeomoniella spp. and one isolate of Phaeoacremonium spp. The disease incidence and severity (length of dark streaks in the vascular system) were evaluated. The municipalities Louveira B, Vinhedo, Jundiaí, Jarinu, Porto Feliz, Sao Miguel Arcanjo and Jales were the localities where the causal agents of the disease were present, demonstrating that the Petri disease occurs throughout São Paulo State. The most prevalent species of Phaeoacremonium was P. minimum (= P. aleophilum). Besides P. minimum, the species P. venezuelense was detected only in the municipality of Jales. P. chlamydospora was the only species identified within this genus. Isolation percentage was higher for P. chlamydospora than for Phaeoacremonium spp. The causal agents of the disease must be isolated by removing fragments of the vascular system from the collar region of symptomatic plants, followed by surface disinfection and plating of fragments in PDA culture medium. Incubation in BOD should be at 23ºC for up to 21 days. The apple-green bait method followed by culturing in PDA did not allow isolation of any of the causal agents of the disease. All inoculated plants developed external symptoms and internally the average length of dark streaks was 7.9 cm for P. chlamydospora and 5.2 cm for P. minimum. Control plants remained healthy. Fungi were re-isolated from diseased plants, completing the Koch’s postulates, thus making official the record of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State, Brazil. |
publishDate |
2017 |
dc.date.none.fl_str_mv |
2017-04-01 2018-12-11T17:33:08Z 2018-12-11T17:33:08Z |
dc.type.status.fl_str_mv |
info:eu-repo/semantics/publishedVersion |
dc.type.driver.fl_str_mv |
info:eu-repo/semantics/article |
format |
article |
status_str |
publishedVersion |
dc.identifier.uri.fl_str_mv |
http://dx.doi.org/10.1590/0100-5405/2154 Summa Phytopathologica, v. 43, n. 2, p. 124-131, 2017. 0100-5405 http://hdl.handle.net/11449/179013 10.1590/0100-5405/2154 S0100-54052017000200124 2-s2.0-85022098680 S0100-54052017000200124.pdf |
url |
http://dx.doi.org/10.1590/0100-5405/2154 http://hdl.handle.net/11449/179013 |
identifier_str_mv |
Summa Phytopathologica, v. 43, n. 2, p. 124-131, 2017. 0100-5405 10.1590/0100-5405/2154 S0100-54052017000200124 2-s2.0-85022098680 S0100-54052017000200124.pdf |
dc.language.iso.fl_str_mv |
por |
language |
por |
dc.relation.none.fl_str_mv |
Summa Phytopathologica 0,258 |
dc.rights.driver.fl_str_mv |
info:eu-repo/semantics/openAccess |
eu_rights_str_mv |
openAccess |
dc.format.none.fl_str_mv |
124-131 application/pdf |
dc.source.none.fl_str_mv |
Scopus reponame:Repositório Institucional da UNESP instname:Universidade Estadual Paulista (UNESP) instacron:UNESP |
instname_str |
Universidade Estadual Paulista (UNESP) |
instacron_str |
UNESP |
institution |
UNESP |
reponame_str |
Repositório Institucional da UNESP |
collection |
Repositório Institucional da UNESP |
repository.name.fl_str_mv |
Repositório Institucional da UNESP - Universidade Estadual Paulista (UNESP) |
repository.mail.fl_str_mv |
|
_version_ |
1799965584186671104 |