Detecção da Brucella spp. em queijos de coalho produzidos com leite cru

• Autor(a) principal: BEZERRA, Suely Santos
• Data de Publicação: 2014
• Tipo de documento: Tese
• Idioma: por
• Título da fonte: Biblioteca Digital de Teses e Dissertações da UFRPE
• Texto Completo: http://www.tede2.ufrpe.br:8080/tede2/handle/tede2/8620
• topic: Queijo coalho; Brucella; Microbiologia; CIENCIAS AGRARIAS::MEDICINA VETERINARIA

Food diseases are strongly associated with the consumption of animal products such as milk and dairy products. Produced mainly in the states of northeastern Brazil, the curd cheese has most of its production from raw material originating from herds of poor sanitary control and establishments, not to count on good manufacturing practices, favoring the contamination product and make vehicle pathogens. Given the fact brucellosis presents itself as a major zoonoses that affects dairy cattle and the possibility of Brucella be conveyed by milk and dairy products, this work aimed to search the Brucella genus bacteria in 30 samples of curd cheese produced from raw milk, marketed in the Parnaíba –PI, Brazil, acquired in the period November 2011 to January 2012. Traditional methods of microbiology and polymerase chain reaction (PCR) were used, so the bacteria identified by both techniques. For traditional microbiological analysis on utilized the Brucella agar and the Thayer Martin agar supplemented with sheep blood and commercial antibiotics Brucella ® ( polymyxin B sulfate : 2500 IU / L 0.5 , bacitracin : 12500 IU / L 0.5 , nystatin : 50000IU / 0.5L , cycloheximide : 50.00 mg / L 0.5 , nalidixic acid : 2.50 mg / L and 0.5 vancomycin : 2.50 mg / L 0.5 ) and VCNT ® ( vancomycin : 1.50 mg / L 0.5 , sulfonated colistin methane : 3.75 mg / L 0,5 , trimethoprim : 2.50 mg / L and 0.5 nystatin : 6250 units / 0.5 L). Morphologically suspicious colonies were confirmed at genus level by the method of polymerase chain reaction (PCR). In analyzes directly performed by PCR, the samples were submitted to DNA extraction from aliquots of 200 μl of a suspension cheeses in Brucella broth. Primers election were those that target 16S - 23S rRNA Brucella spp.: ITS66: ACATAGATCGCAGGCCAGTCA and ITS279: AGATACCGACGCAAACGCTAC. Among the 30 samples analyzed in duplicate by traditional methods of microbiology, 11 suspected colonies were isolated, all grown on Thayer Martin agar. Among these, seven were confirmed by PCR as bacteria of the genus Brucella, coming from six samples. Seven samples were positive when analyzed directly by PCR. It can be concluded that curd cheese sold in the city of Parnaíba – PI, Brazil, are potential vehicles of Brucella spp. to their consumers, which indicates the need for greater control throughout the production chain of this product, especially concerning health of dairy cattle, the primary source of contamination, as well as constant monitoring of the quality of the product offered to the population in order to minimize risks to public health.