Detecção da Brucella spp. em queijos de coalho produzidos com leite cru
Autor(a) principal: | |
---|---|
Data de Publicação: | 2014 |
Tipo de documento: | Tese |
Idioma: | por |
Título da fonte: | Biblioteca Digital de Teses e Dissertações da UFRPE |
Texto Completo: | http://www.tede2.ufrpe.br:8080/tede2/handle/tede2/8620 |
Resumo: | Food diseases are strongly associated with the consumption of animal products such as milk and dairy products. Produced mainly in the states of northeastern Brazil, the curd cheese has most of its production from raw material originating from herds of poor sanitary control and establishments, not to count on good manufacturing practices, favoring the contamination product and make vehicle pathogens. Given the fact brucellosis presents itself as a major zoonoses that affects dairy cattle and the possibility of Brucella be conveyed by milk and dairy products, this work aimed to search the Brucella genus bacteria in 30 samples of curd cheese produced from raw milk, marketed in the Parnaíba –PI, Brazil, acquired in the period November 2011 to January 2012. Traditional methods of microbiology and polymerase chain reaction (PCR) were used, so the bacteria identified by both techniques. For traditional microbiological analysis on utilized the Brucella agar and the Thayer Martin agar supplemented with sheep blood and commercial antibiotics Brucella ® ( polymyxin B sulfate : 2500 IU / L 0.5 , bacitracin : 12500 IU / L 0.5 , nystatin : 50000IU / 0.5L , cycloheximide : 50.00 mg / L 0.5 , nalidixic acid : 2.50 mg / L and 0.5 vancomycin : 2.50 mg / L 0.5 ) and VCNT ® ( vancomycin : 1.50 mg / L 0.5 , sulfonated colistin methane : 3.75 mg / L 0,5 , trimethoprim : 2.50 mg / L and 0.5 nystatin : 6250 units / 0.5 L). Morphologically suspicious colonies were confirmed at genus level by the method of polymerase chain reaction (PCR). In analyzes directly performed by PCR, the samples were submitted to DNA extraction from aliquots of 200 μl of a suspension cheeses in Brucella broth. Primers election were those that target 16S - 23S rRNA Brucella spp.: ITS66: ACATAGATCGCAGGCCAGTCA and ITS279: AGATACCGACGCAAACGCTAC. Among the 30 samples analyzed in duplicate by traditional methods of microbiology, 11 suspected colonies were isolated, all grown on Thayer Martin agar. Among these, seven were confirmed by PCR as bacteria of the genus Brucella, coming from six samples. Seven samples were positive when analyzed directly by PCR. It can be concluded that curd cheese sold in the city of Parnaíba – PI, Brazil, are potential vehicles of Brucella spp. to their consumers, which indicates the need for greater control throughout the production chain of this product, especially concerning health of dairy cattle, the primary source of contamination, as well as constant monitoring of the quality of the product offered to the population in order to minimize risks to public health. |
id |
URPE_569a345c3362b414bdcc265eb1e32442 |
---|---|
oai_identifier_str |
oai:tede2:tede2/8620 |
network_acronym_str |
URPE |
network_name_str |
Biblioteca Digital de Teses e Dissertações da UFRPE |
repository_id_str |
|
spelling |
MENDES, Emiko ShinozakiLOPES, Carlos Alberto de MagalhãesALMEIDA, Erivânia Camelo deSHINOHARA, Neide Kazue SakugawaSILVA, Leonildo Bento Galiza dahttp://lattes.cnpq.br/5011177463533503BEZERRA, Suely Santos2022-08-23T11:00:38Z2014-02-20BEZERRA, Suely Santos. Detecção da Brucella spp. em queijos de coalho produzidos com leite cru. 2014. 86 f. Tese (Programa de Pós-Graduação em Ciência Veterinária) - Universidade Federal Rural de Pernambuco, Recife.http://www.tede2.ufrpe.br:8080/tede2/handle/tede2/8620Food diseases are strongly associated with the consumption of animal products such as milk and dairy products. Produced mainly in the states of northeastern Brazil, the curd cheese has most of its production from raw material originating from herds of poor sanitary control and establishments, not to count on good manufacturing practices, favoring the contamination product and make vehicle pathogens. Given the fact brucellosis presents itself as a major zoonoses that affects dairy cattle and the possibility of Brucella be conveyed by milk and dairy products, this work aimed to search the Brucella genus bacteria in 30 samples of curd cheese produced from raw milk, marketed in the Parnaíba –PI, Brazil, acquired in the period November 2011 to January 2012. Traditional methods of microbiology and polymerase chain reaction (PCR) were used, so the bacteria identified by both techniques. For traditional microbiological analysis on utilized the Brucella agar and the Thayer Martin agar supplemented with sheep blood and commercial antibiotics Brucella ® ( polymyxin B sulfate : 2500 IU / L 0.5 , bacitracin : 12500 IU / L 0.5 , nystatin : 50000IU / 0.5L , cycloheximide : 50.00 mg / L 0.5 , nalidixic acid : 2.50 mg / L and 0.5 vancomycin : 2.50 mg / L 0.5 ) and VCNT ® ( vancomycin : 1.50 mg / L 0.5 , sulfonated colistin methane : 3.75 mg / L 0,5 , trimethoprim : 2.50 mg / L and 0.5 nystatin : 6250 units / 0.5 L). Morphologically suspicious colonies were confirmed at genus level by the method of polymerase chain reaction (PCR). In analyzes directly performed by PCR, the samples were submitted to DNA extraction from aliquots of 200 μl of a suspension cheeses in Brucella broth. Primers election were those that target 16S - 23S rRNA Brucella spp.: ITS66: ACATAGATCGCAGGCCAGTCA and ITS279: AGATACCGACGCAAACGCTAC. Among the 30 samples analyzed in duplicate by traditional methods of microbiology, 11 suspected colonies were isolated, all grown on Thayer Martin agar. Among these, seven were confirmed by PCR as bacteria of the genus Brucella, coming from six samples. Seven samples were positive when analyzed directly by PCR. It can be concluded that curd cheese sold in the city of Parnaíba – PI, Brazil, are potential vehicles of Brucella spp. to their consumers, which indicates the need for greater control throughout the production chain of this product, especially concerning health of dairy cattle, the primary source of contamination, as well as constant monitoring of the quality of the product offered to the population in order to minimize risks to public health.Doenças de origem alimentar estão fortemente associadas ao consumo de produtos de origem animal, tais como leite e seus derivados. Produzido, principalmente nos Estados do nordeste do Brasil, o queijo de coalho tem a maior parte de sua produção obtida de matéria-prima oriunda de rebanhos carentes de controle sanitário e em estabelecimentos que, por não contarem com boas práticas de fabricação, favorecem contaminações do produto e o tornam veículo de diferentes patógenos. Dado ao fato de a brucelose apresentar-se como uma das principais zoonoses que acometem bovinos leiteiros e pela possibilidade da Brucella ser veiculada por leite e derivados, objetivou-se pesquisar bactérias do gênero Brucella em 30 amostras de queijos de coalho produzidos com leite cru, comercializados na cidade de Parnaíba-PI, adquiridas no período de novembro de 2011 a janeiro de 2012. Foram utilizados métodos tradicionais da microbiologia e reação da polimerase em cadeia (PCR), sendo a bactéria identificada por ambas as técnicas. Para as análises microbiológicas tradicionais, utilizaram-se Ágar Brucella e Ágar Thayer Martin suplementados com sangue de carneiro disfibrinado e com os antibióticos comerciais Brucella® (sulfato de polimixina B: 2500 IU/0,5L, bacitracina: 12500 IU/0,5L, nistatina: 50000IU/0,5L, cicloheximida: 50.00 mg/0,5L, ácido nalidixico: 2.50 mg/0,5L e vancomicina: 2.50 mg/0,5L) e V.C.N.T.® (vancomicina: 1.50 mg/0,5L, sulfonado metano colistina: 3.75 mg/0,5L, trimetoprim: 2.50 mg/0,5L e nistatina: 6250 unidades/0,5L). As colônias morfologicamente suspeitas foram confirmadas em nível de gênero pelo método de reação da polimerase em cadeia (PCR). Nas análises realizadas diretamente por PCR, as amostras foram submetidas à extração de DNA a partir de alíquotas de 200 μL de uma suspensão dos queijos em caldo Brucella. Os primers de eleição foram aqueles que têm por alvo região 16S-23S do rRNA para Brucella spp.: ITS66: ACATAGATCGCAGGCCAGTCA e ITS279: AGATACCGACGCAAACGCTAC. Das 30 amostras analisadas em duplicatas por métodos tradicionais da microbiologia foram isoladas colônias suspeitas de 11, todas cultivadas em ágar Thayer Martin. Dessas, sete foram confirmadas por PCR como bactérias do gênero Brucella, procedentes de seis amostras. Sete amostras foram positivas quando analisadas diretamente por PCR. Conclui-se que os queijos de coalho comercializados na cidade de Parnaíba são veículos em potencial de Brucella spp. para seus consumidores, o que denota a necessidade de maior controle em toda a cadeia produtiva desse produto, principalmente no tocante à sanidade dos rebanhos leiteiros, fonte primária de contaminação, além de um acompanhamento constante da qualidade do produto oferecido à população de forma a minimizar riscos à saúde pública.Submitted by Mario BC (mario@bc.ufrpe.br) on 2022-08-23T11:00:38Z No. of bitstreams: 1 Suely Santos Bezerra.pdf: 1609437 bytes, checksum: a1e878c335469ed8bfe945a8c74970d7 (MD5)Made available in DSpace on 2022-08-23T11:00:38Z (GMT). No. of bitstreams: 1 Suely Santos Bezerra.pdf: 1609437 bytes, checksum: a1e878c335469ed8bfe945a8c74970d7 (MD5) Previous issue date: 2014-02-20application/pdfporUniversidade Federal Rural de PernambucoPrograma de Pós-Graduação em Ciência VeterináriaUFRPEBrasilDepartamento de Medicina VeterináriaQueijo coalhoBrucellaMicrobiologiaCIENCIAS AGRARIAS::MEDICINA VETERINARIADetecção da Brucella spp. em queijos de coalho produzidos com leite cruinfo:eu-repo/semantics/publishedVersioninfo:eu-repo/semantics/doctoralThesis-3061482854177903105600600600-3020210563763616780453670264235017319info:eu-repo/semantics/openAccessreponame:Biblioteca Digital de Teses e Dissertações da UFRPEinstname:Universidade Federal Rural de Pernambuco (UFRPE)instacron:UFRPEORIGINALSuely Santos Bezerra.pdfSuely Santos Bezerra.pdfapplication/pdf1609437http://www.tede2.ufrpe.br:8080/tede2/bitstream/tede2/8620/2/Suely+Santos+Bezerra.pdfa1e878c335469ed8bfe945a8c74970d7MD52LICENSElicense.txtlicense.txttext/plain; charset=utf-82165http://www.tede2.ufrpe.br:8080/tede2/bitstream/tede2/8620/1/license.txtbd3efa91386c1718a7f26a329fdcb468MD51tede2/86202022-08-23 08:00:38.9oai:tede2:tede2/8620Tk9UQTogQ09MT1FVRSBBUVVJIEEgU1VBIFBSw5NQUklBIExJQ0VOw4dBCkVzdGEgbGljZW7Dp2EgZGUgZXhlbXBsbyDDqSBmb3JuZWNpZGEgYXBlbmFzIHBhcmEgZmlucyBpbmZvcm1hdGl2b3MuCgpMSUNFTsOHQSBERSBESVNUUklCVUnDh8ODTyBOw4NPLUVYQ0xVU0lWQQoKQ29tIGEgYXByZXNlbnRhw6fDo28gZGVzdGEgbGljZW7Dp2EsIHZvY8OqIChvIGF1dG9yIChlcykgb3UgbyB0aXR1bGFyIGRvcyBkaXJlaXRvcyBkZSBhdXRvcikgY29uY2VkZSDDoCBVbml2ZXJzaWRhZGUgClhYWCAoU2lnbGEgZGEgVW5pdmVyc2lkYWRlKSBvIGRpcmVpdG8gbsOjby1leGNsdXNpdm8gZGUgcmVwcm9kdXppciwgIHRyYWR1emlyIChjb25mb3JtZSBkZWZpbmlkbyBhYmFpeG8pLCBlL291IApkaXN0cmlidWlyIGEgc3VhIHRlc2Ugb3UgZGlzc2VydGHDp8OjbyAoaW5jbHVpbmRvIG8gcmVzdW1vKSBwb3IgdG9kbyBvIG11bmRvIG5vIGZvcm1hdG8gaW1wcmVzc28gZSBlbGV0csO0bmljbyBlIAplbSBxdWFscXVlciBtZWlvLCBpbmNsdWluZG8gb3MgZm9ybWF0b3Mgw6F1ZGlvIG91IHbDrWRlby4KClZvY8OqIGNvbmNvcmRhIHF1ZSBhIFNpZ2xhIGRlIFVuaXZlcnNpZGFkZSBwb2RlLCBzZW0gYWx0ZXJhciBvIGNvbnRlw7pkbywgdHJhbnNwb3IgYSBzdWEgdGVzZSBvdSBkaXNzZXJ0YcOnw6NvIApwYXJhIHF1YWxxdWVyIG1laW8gb3UgZm9ybWF0byBwYXJhIGZpbnMgZGUgcHJlc2VydmHDp8Ojby4KClZvY8OqIHRhbWLDqW0gY29uY29yZGEgcXVlIGEgU2lnbGEgZGUgVW5pdmVyc2lkYWRlIHBvZGUgbWFudGVyIG1haXMgZGUgdW1hIGPDs3BpYSBhIHN1YSB0ZXNlIG91IApkaXNzZXJ0YcOnw6NvIHBhcmEgZmlucyBkZSBzZWd1cmFuw6dhLCBiYWNrLXVwIGUgcHJlc2VydmHDp8Ojby4KClZvY8OqIGRlY2xhcmEgcXVlIGEgc3VhIHRlc2Ugb3UgZGlzc2VydGHDp8OjbyDDqSBvcmlnaW5hbCBlIHF1ZSB2b2PDqiB0ZW0gbyBwb2RlciBkZSBjb25jZWRlciBvcyBkaXJlaXRvcyBjb250aWRvcyAKbmVzdGEgbGljZW7Dp2EuIFZvY8OqIHRhbWLDqW0gZGVjbGFyYSBxdWUgbyBkZXDDs3NpdG8gZGEgc3VhIHRlc2Ugb3UgZGlzc2VydGHDp8OjbyBuw6NvLCBxdWUgc2VqYSBkZSBzZXUgCmNvbmhlY2ltZW50bywgaW5mcmluZ2UgZGlyZWl0b3MgYXV0b3JhaXMgZGUgbmluZ3XDqW0uCgpDYXNvIGEgc3VhIHRlc2Ugb3UgZGlzc2VydGHDp8OjbyBjb250ZW5oYSBtYXRlcmlhbCBxdWUgdm9jw6ogbsOjbyBwb3NzdWkgYSB0aXR1bGFyaWRhZGUgZG9zIGRpcmVpdG9zIGF1dG9yYWlzLCB2b2PDqiAKZGVjbGFyYSBxdWUgb2J0ZXZlIGEgcGVybWlzc8OjbyBpcnJlc3RyaXRhIGRvIGRldGVudG9yIGRvcyBkaXJlaXRvcyBhdXRvcmFpcyBwYXJhIGNvbmNlZGVyIMOgIFNpZ2xhIGRlIFVuaXZlcnNpZGFkZSAKb3MgZGlyZWl0b3MgYXByZXNlbnRhZG9zIG5lc3RhIGxpY2Vuw6dhLCBlIHF1ZSBlc3NlIG1hdGVyaWFsIGRlIHByb3ByaWVkYWRlIGRlIHRlcmNlaXJvcyBlc3TDoSBjbGFyYW1lbnRlIAppZGVudGlmaWNhZG8gZSByZWNvbmhlY2lkbyBubyB0ZXh0byBvdSBubyBjb250ZcO6ZG8gZGEgdGVzZSBvdSBkaXNzZXJ0YcOnw6NvIG9yYSBkZXBvc2l0YWRhLgoKQ0FTTyBBIFRFU0UgT1UgRElTU0VSVEHDh8ODTyBPUkEgREVQT1NJVEFEQSBURU5IQSBTSURPIFJFU1VMVEFETyBERSBVTSBQQVRST0PDjU5JTyBPVSAKQVBPSU8gREUgVU1BIEFHw4pOQ0lBIERFIEZPTUVOVE8gT1UgT1VUUk8gT1JHQU5JU01PIFFVRSBOw4NPIFNFSkEgQSBTSUdMQSBERSAKVU5JVkVSU0lEQURFLCBWT0PDiiBERUNMQVJBIFFVRSBSRVNQRUlUT1UgVE9ET1MgRSBRVUFJU1FVRVIgRElSRUlUT1MgREUgUkVWSVPDg08gQ09NTyAKVEFNQsOJTSBBUyBERU1BSVMgT0JSSUdBw4fDlUVTIEVYSUdJREFTIFBPUiBDT05UUkFUTyBPVSBBQ09SRE8uCgpBIFNpZ2xhIGRlIFVuaXZlcnNpZGFkZSBzZSBjb21wcm9tZXRlIGEgaWRlbnRpZmljYXIgY2xhcmFtZW50ZSBvIHNldSBub21lIChzKSBvdSBvKHMpIG5vbWUocykgZG8ocykgCmRldGVudG9yKGVzKSBkb3MgZGlyZWl0b3MgYXV0b3JhaXMgZGEgdGVzZSBvdSBkaXNzZXJ0YcOnw6NvLCBlIG7Do28gZmFyw6EgcXVhbHF1ZXIgYWx0ZXJhw6fDo28sIGFsw6ltIGRhcXVlbGFzIApjb25jZWRpZGFzIHBvciBlc3RhIGxpY2Vuw6dhLgo=Biblioteca Digital de Teses e Dissertaçõeshttp://www.tede2.ufrpe.br:8080/tede/PUBhttp://www.tede2.ufrpe.br:8080/oai/requestbdtd@ufrpe.br ||bdtd@ufrpe.bropendoar:2024-05-28T12:37:13.312388Biblioteca Digital de Teses e Dissertações da UFRPE - Universidade Federal Rural de Pernambuco (UFRPE)false |
dc.title.por.fl_str_mv |
Detecção da Brucella spp. em queijos de coalho produzidos com leite cru |
title |
Detecção da Brucella spp. em queijos de coalho produzidos com leite cru |
spellingShingle |
Detecção da Brucella spp. em queijos de coalho produzidos com leite cru BEZERRA, Suely Santos Queijo coalho Brucella Microbiologia CIENCIAS AGRARIAS::MEDICINA VETERINARIA |
title_short |
Detecção da Brucella spp. em queijos de coalho produzidos com leite cru |
title_full |
Detecção da Brucella spp. em queijos de coalho produzidos com leite cru |
title_fullStr |
Detecção da Brucella spp. em queijos de coalho produzidos com leite cru |
title_full_unstemmed |
Detecção da Brucella spp. em queijos de coalho produzidos com leite cru |
title_sort |
Detecção da Brucella spp. em queijos de coalho produzidos com leite cru |
author |
BEZERRA, Suely Santos |
author_facet |
BEZERRA, Suely Santos |
author_role |
author |
dc.contributor.advisor1.fl_str_mv |
MENDES, Emiko Shinozaki |
dc.contributor.referee1.fl_str_mv |
LOPES, Carlos Alberto de Magalhães |
dc.contributor.referee2.fl_str_mv |
ALMEIDA, Erivânia Camelo de |
dc.contributor.referee3.fl_str_mv |
SHINOHARA, Neide Kazue Sakugawa |
dc.contributor.referee4.fl_str_mv |
SILVA, Leonildo Bento Galiza da |
dc.contributor.authorLattes.fl_str_mv |
http://lattes.cnpq.br/5011177463533503 |
dc.contributor.author.fl_str_mv |
BEZERRA, Suely Santos |
contributor_str_mv |
MENDES, Emiko Shinozaki LOPES, Carlos Alberto de Magalhães ALMEIDA, Erivânia Camelo de SHINOHARA, Neide Kazue Sakugawa SILVA, Leonildo Bento Galiza da |
dc.subject.por.fl_str_mv |
Queijo coalho Brucella Microbiologia |
topic |
Queijo coalho Brucella Microbiologia CIENCIAS AGRARIAS::MEDICINA VETERINARIA |
dc.subject.cnpq.fl_str_mv |
CIENCIAS AGRARIAS::MEDICINA VETERINARIA |
description |
Food diseases are strongly associated with the consumption of animal products such as milk and dairy products. Produced mainly in the states of northeastern Brazil, the curd cheese has most of its production from raw material originating from herds of poor sanitary control and establishments, not to count on good manufacturing practices, favoring the contamination product and make vehicle pathogens. Given the fact brucellosis presents itself as a major zoonoses that affects dairy cattle and the possibility of Brucella be conveyed by milk and dairy products, this work aimed to search the Brucella genus bacteria in 30 samples of curd cheese produced from raw milk, marketed in the Parnaíba –PI, Brazil, acquired in the period November 2011 to January 2012. Traditional methods of microbiology and polymerase chain reaction (PCR) were used, so the bacteria identified by both techniques. For traditional microbiological analysis on utilized the Brucella agar and the Thayer Martin agar supplemented with sheep blood and commercial antibiotics Brucella ® ( polymyxin B sulfate : 2500 IU / L 0.5 , bacitracin : 12500 IU / L 0.5 , nystatin : 50000IU / 0.5L , cycloheximide : 50.00 mg / L 0.5 , nalidixic acid : 2.50 mg / L and 0.5 vancomycin : 2.50 mg / L 0.5 ) and VCNT ® ( vancomycin : 1.50 mg / L 0.5 , sulfonated colistin methane : 3.75 mg / L 0,5 , trimethoprim : 2.50 mg / L and 0.5 nystatin : 6250 units / 0.5 L). Morphologically suspicious colonies were confirmed at genus level by the method of polymerase chain reaction (PCR). In analyzes directly performed by PCR, the samples were submitted to DNA extraction from aliquots of 200 μl of a suspension cheeses in Brucella broth. Primers election were those that target 16S - 23S rRNA Brucella spp.: ITS66: ACATAGATCGCAGGCCAGTCA and ITS279: AGATACCGACGCAAACGCTAC. Among the 30 samples analyzed in duplicate by traditional methods of microbiology, 11 suspected colonies were isolated, all grown on Thayer Martin agar. Among these, seven were confirmed by PCR as bacteria of the genus Brucella, coming from six samples. Seven samples were positive when analyzed directly by PCR. It can be concluded that curd cheese sold in the city of Parnaíba – PI, Brazil, are potential vehicles of Brucella spp. to their consumers, which indicates the need for greater control throughout the production chain of this product, especially concerning health of dairy cattle, the primary source of contamination, as well as constant monitoring of the quality of the product offered to the population in order to minimize risks to public health. |
publishDate |
2014 |
dc.date.issued.fl_str_mv |
2014-02-20 |
dc.date.accessioned.fl_str_mv |
2022-08-23T11:00:38Z |
dc.type.status.fl_str_mv |
info:eu-repo/semantics/publishedVersion |
dc.type.driver.fl_str_mv |
info:eu-repo/semantics/doctoralThesis |
format |
doctoralThesis |
status_str |
publishedVersion |
dc.identifier.citation.fl_str_mv |
BEZERRA, Suely Santos. Detecção da Brucella spp. em queijos de coalho produzidos com leite cru. 2014. 86 f. Tese (Programa de Pós-Graduação em Ciência Veterinária) - Universidade Federal Rural de Pernambuco, Recife. |
dc.identifier.uri.fl_str_mv |
http://www.tede2.ufrpe.br:8080/tede2/handle/tede2/8620 |
identifier_str_mv |
BEZERRA, Suely Santos. Detecção da Brucella spp. em queijos de coalho produzidos com leite cru. 2014. 86 f. Tese (Programa de Pós-Graduação em Ciência Veterinária) - Universidade Federal Rural de Pernambuco, Recife. |
url |
http://www.tede2.ufrpe.br:8080/tede2/handle/tede2/8620 |
dc.language.iso.fl_str_mv |
por |
language |
por |
dc.relation.program.fl_str_mv |
-3061482854177903105 |
dc.relation.confidence.fl_str_mv |
600 600 600 |
dc.relation.department.fl_str_mv |
-3020210563763616780 |
dc.relation.cnpq.fl_str_mv |
453670264235017319 |
dc.rights.driver.fl_str_mv |
info:eu-repo/semantics/openAccess |
eu_rights_str_mv |
openAccess |
dc.format.none.fl_str_mv |
application/pdf |
dc.publisher.none.fl_str_mv |
Universidade Federal Rural de Pernambuco |
dc.publisher.program.fl_str_mv |
Programa de Pós-Graduação em Ciência Veterinária |
dc.publisher.initials.fl_str_mv |
UFRPE |
dc.publisher.country.fl_str_mv |
Brasil |
dc.publisher.department.fl_str_mv |
Departamento de Medicina Veterinária |
publisher.none.fl_str_mv |
Universidade Federal Rural de Pernambuco |
dc.source.none.fl_str_mv |
reponame:Biblioteca Digital de Teses e Dissertações da UFRPE instname:Universidade Federal Rural de Pernambuco (UFRPE) instacron:UFRPE |
instname_str |
Universidade Federal Rural de Pernambuco (UFRPE) |
instacron_str |
UFRPE |
institution |
UFRPE |
reponame_str |
Biblioteca Digital de Teses e Dissertações da UFRPE |
collection |
Biblioteca Digital de Teses e Dissertações da UFRPE |
bitstream.url.fl_str_mv |
http://www.tede2.ufrpe.br:8080/tede2/bitstream/tede2/8620/2/Suely+Santos+Bezerra.pdf http://www.tede2.ufrpe.br:8080/tede2/bitstream/tede2/8620/1/license.txt |
bitstream.checksum.fl_str_mv |
a1e878c335469ed8bfe945a8c74970d7 bd3efa91386c1718a7f26a329fdcb468 |
bitstream.checksumAlgorithm.fl_str_mv |
MD5 MD5 |
repository.name.fl_str_mv |
Biblioteca Digital de Teses e Dissertações da UFRPE - Universidade Federal Rural de Pernambuco (UFRPE) |
repository.mail.fl_str_mv |
bdtd@ufrpe.br ||bdtd@ufrpe.br |
_version_ |
1810102265732661248 |