Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

Detalhes bibliográficos
Autor(a) principal: Bechara,IJ.
Data de Publicação: 2011
Outros Autores: Destéfano,RHR., Bresil,C., Messias,CL.
Tipo de documento: Artigo
Idioma: eng
Título da fonte: Brazilian Journal of Biology
Texto Completo: http://old.scielo.br/scielo.php?script=sci_arttext&pid=S1519-69842011000100014
Resumo: The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
id IIE-1_0d4f7979897e8e58ef8b2e18ea0ea7d8
oai_identifier_str oai:scielo:S1519-69842011000100014
network_acronym_str IIE-1
network_name_str Brazilian Journal of Biology
repository_id_str
spelling Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)Metarhizium anastrephafruit fly controlhistologyPCR analysisThe fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.Instituto Internacional de Ecologia2011-02-01info:eu-repo/semantics/articleinfo:eu-repo/semantics/publishedVersiontext/htmlhttp://old.scielo.br/scielo.php?script=sci_arttext&pid=S1519-69842011000100014Brazilian Journal of Biology v.71 n.1 2011reponame:Brazilian Journal of Biologyinstname:Instituto Internacional de Ecologia (IIE)instacron:IIE10.1590/S1519-69842011000100014info:eu-repo/semantics/openAccessBechara,IJ.Destéfano,RHR.Bresil,C.Messias,CL.eng2011-03-14T00:00:00Zoai:scielo:S1519-69842011000100014Revistahttps://www.scielo.br/j/bjb/https://old.scielo.br/oai/scielo-oai.phpbjb@bjb.com.br||bjb@bjb.com.br1678-43751519-6984opendoar:2011-03-14T00:00Brazilian Journal of Biology - Instituto Internacional de Ecologia (IIE)false
dc.title.none.fl_str_mv Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)
title Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)
spellingShingle Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)
Bechara,IJ.
Metarhizium anastrepha
fruit fly control
histology
PCR analysis
title_short Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)
title_full Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)
title_fullStr Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)
title_full_unstemmed Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)
title_sort Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)
author Bechara,IJ.
author_facet Bechara,IJ.
Destéfano,RHR.
Bresil,C.
Messias,CL.
author_role author
author2 Destéfano,RHR.
Bresil,C.
Messias,CL.
author2_role author
author
author
dc.contributor.author.fl_str_mv Bechara,IJ.
Destéfano,RHR.
Bresil,C.
Messias,CL.
dc.subject.por.fl_str_mv Metarhizium anastrepha
fruit fly control
histology
PCR analysis
topic Metarhizium anastrepha
fruit fly control
histology
PCR analysis
description The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
publishDate 2011
dc.date.none.fl_str_mv 2011-02-01
dc.type.driver.fl_str_mv info:eu-repo/semantics/article
dc.type.status.fl_str_mv info:eu-repo/semantics/publishedVersion
format article
status_str publishedVersion
dc.identifier.uri.fl_str_mv http://old.scielo.br/scielo.php?script=sci_arttext&pid=S1519-69842011000100014
url http://old.scielo.br/scielo.php?script=sci_arttext&pid=S1519-69842011000100014
dc.language.iso.fl_str_mv eng
language eng
dc.relation.none.fl_str_mv 10.1590/S1519-69842011000100014
dc.rights.driver.fl_str_mv info:eu-repo/semantics/openAccess
eu_rights_str_mv openAccess
dc.format.none.fl_str_mv text/html
dc.publisher.none.fl_str_mv Instituto Internacional de Ecologia
publisher.none.fl_str_mv Instituto Internacional de Ecologia
dc.source.none.fl_str_mv Brazilian Journal of Biology v.71 n.1 2011
reponame:Brazilian Journal of Biology
instname:Instituto Internacional de Ecologia (IIE)
instacron:IIE
instname_str Instituto Internacional de Ecologia (IIE)
instacron_str IIE
institution IIE
reponame_str Brazilian Journal of Biology
collection Brazilian Journal of Biology
repository.name.fl_str_mv Brazilian Journal of Biology - Instituto Internacional de Ecologia (IIE)
repository.mail.fl_str_mv bjb@bjb.com.br||bjb@bjb.com.br
_version_ 1752129878788931584