Estudo genômico e proteômico do fitopatógeno Alternaria alternata na cultura do mamão
Autor(a) principal: | |
---|---|
Data de Publicação: | 2019 |
Tipo de documento: | Dissertação |
Idioma: | por |
Título da fonte: | Repositório Digital da Universidade Federal Rural do Semi-Árido (RDU) |
Texto Completo: | https://repositorio.ufersa.edu.br/handle/prefix/1862 |
Resumo: | Brazil is the second largest producer and third largest exporter of papaya. The intensive cultivation of papaya in fixed areas has favored fungal diseases capable of causing losses in the field and in the post-harvest period. Foliar lesions of fungal origin impair the photosynthetic capacity of the plant, leading to its death and facilitating the invasion into the fruit of pathogens causing rot during maturation, and being responsible for the more severe losses. In the culture of papaya, Alternaria alternata is capable of causing damage both in the fruit and in the leaf. The aim of the present work was to establish a rapid and sensitive diagnosis of A. alternata infection in papaya culture, and to investigate proteins related to such infection. In the present study, gene specific primers based on the Alt a 1 gene sequence (AaltDAlta1 - CGCATCCTGCCCTGTCA / AinfIAlta1 - GTTGGTAGCCTTGATGTTGAAGC) were used to make a rapid and safe molecular diagnosis of A. alternata infection in papaya producting areas of Rio Grande do Norte . In addition to genomic analysis, SDS-PAGE-based proteomic analysis was used to separate proteins extracted from control and inoculated groups of papaya seedlings of the Tainung and Feltrin varieties, in order to investigate differentially expressed proteins with potential to interfere in the pathology establishment process. The results of the genomic analysis showed that in 100% of the producting areas analyzed, the presence of the fungus A. alternata was found infecting papaya plants in the state of Rio Grande do Norte. In the evaluation of the symptoms after inoculation, it was noticed that the Feltrin variety possibly presents a greater resistance to the infection, due to having presented milder symptoms. With the proteomic evaluations, it was observed that in the Tainung variety the seedlings inoculated with A. alternata showed reduction of the expressed protein content. Among the inhibited proteins, RuBisCo protein, involved in plant photosynthetic metabolism, was identified. Thus, it is suggested that the inhibition of Rubisco protein may be involved in the mechanisms that lead to the appearance of symptoms related to pathogenesis |
id |
UFER_e57b0f4c42b9b4fc4b627f1cf8f130af |
---|---|
oai_identifier_str |
oai:repositorio.ufersa.edu.br:prefix/1862 |
network_acronym_str |
UFER |
network_name_str |
Repositório Digital da Universidade Federal Rural do Semi-Árido (RDU) |
repository_id_str |
|
spelling |
Estudo genômico e proteômico do fitopatógeno Alternaria alternata na cultura do mamãoDiagnóstico molecularCarica papayaProteômicaMolecular diagnosisCarica papayaProteomicsCNPQ::CIENCIAS AMBIENTAIS::MEIO AMBIENTEBrazil is the second largest producer and third largest exporter of papaya. The intensive cultivation of papaya in fixed areas has favored fungal diseases capable of causing losses in the field and in the post-harvest period. Foliar lesions of fungal origin impair the photosynthetic capacity of the plant, leading to its death and facilitating the invasion into the fruit of pathogens causing rot during maturation, and being responsible for the more severe losses. In the culture of papaya, Alternaria alternata is capable of causing damage both in the fruit and in the leaf. The aim of the present work was to establish a rapid and sensitive diagnosis of A. alternata infection in papaya culture, and to investigate proteins related to such infection. In the present study, gene specific primers based on the Alt a 1 gene sequence (AaltDAlta1 - CGCATCCTGCCCTGTCA / AinfIAlta1 - GTTGGTAGCCTTGATGTTGAAGC) were used to make a rapid and safe molecular diagnosis of A. alternata infection in papaya producting areas of Rio Grande do Norte . In addition to genomic analysis, SDS-PAGE-based proteomic analysis was used to separate proteins extracted from control and inoculated groups of papaya seedlings of the Tainung and Feltrin varieties, in order to investigate differentially expressed proteins with potential to interfere in the pathology establishment process. The results of the genomic analysis showed that in 100% of the producting areas analyzed, the presence of the fungus A. alternata was found infecting papaya plants in the state of Rio Grande do Norte. In the evaluation of the symptoms after inoculation, it was noticed that the Feltrin variety possibly presents a greater resistance to the infection, due to having presented milder symptoms. With the proteomic evaluations, it was observed that in the Tainung variety the seedlings inoculated with A. alternata showed reduction of the expressed protein content. Among the inhibited proteins, RuBisCo protein, involved in plant photosynthetic metabolism, was identified. Thus, it is suggested that the inhibition of Rubisco protein may be involved in the mechanisms that lead to the appearance of symptoms related to pathogenesisO Brasil é o segundo maior produtor e terceiro maior exportador mundial de mamão. O cultivo intensivo de mamoeiros em áreas fixas tem favorecido doenças fúngicas capazes de causar perdas no campo e também no período pós-colheita. Lesões foliares de origem fúngica prejudicam a capacidade fotossintética da planta podendo levá-la a morte, além de facilitar a invasão no fruto de patógenos causadores de podridão durante o amadurecimento, sendo responsáveis pelas perdas mais severas. Na cultura do mamão, a Alternaria alternata é capaz de causar danos tanto no fruto como também na folha. O objetivo do presente trabalho foi estabelecer um diagnóstico rápido e sensível da infecção de A. alternata na cultura do mamão, e investigar proteínas relacionadas a tal infecção. No presente estudo, primers gene específicos baseados na sequência do gene Al a 1 (AaltDAlta1 – CGCATCCTGCCCTGTCA/ AinfIAlta1 - GTTGGTAGCCTTGATGTTGAAGC), foram utilizados para se fazer o diagnóstico molecular rápido e seguro da infecção de A. alternata em áreas produtoras do Rio Grande do Norte. Além da análise genômica, análise proteômica baseada em SDS-PAGE foi utilizada para separar proteínas extraídas de grupos controle e inoculado de mudas de mamão das variedades Tainung e Feltrin, a fim de investigar proteínas diferencialmente expressas com potencial de interferir no processo de estabelecimento da patologia. Os resultados da análise genômica mostraram que em 100% das áreas produtoras analisadas, foi encontrada a presença do fungo A. alternata, infectando mamoeiros no estado do Rio Grande do Norte. Na avaliação dos sintomas após inoculação, foi percebido que a variedade Feltrin possivelmente apresenta uma maior resistência à infecção, por ter apresentado sintomas mais brandos. Com as avaliações proteômicas, foi visto que na variedade Tainung as mudas inoculadas com A. alternata apresentaram redução do conteúdo proteico expresso. Dentre as proteínas inibidas, identificou-se a proteína RuBisCo, envolvida no metabolismo fotossintético vegetal. Assim, sugere-se que a inibição da proteína Rubisco possa estar envolvida nos mecanismos que levam ao surgimento dos sintomas relacionados a patogeniaTrabalho não financiado por agência de fomento, ou autofinanciadoUniversidade Federal Rural do Semi-ÁridoBrasilCentro de Ciências Agrárias - CCAUFERSAPrograma de Pós-Graduação em Ambiente, Tecnologia e SociedadeJereissati, Emmanuel de Sousa63418282334http://buscatextual.cnpq.br/buscatextual/visualizacv.do?id=K4735133D5Sales Junior, Rui87634325449http://buscatextual.cnpq.br/buscatextual/visualizacv.do?id=K4707958E1Holanda, Ioná Santos Araújo65180062500http://buscatextual.cnpq.br/buscatextual/visualizacv.do?id=K4769347E0Holanda, Ioná Santos Araújo65180062500http://buscatextual.cnpq.br/buscatextual/visualizacv.do?id=K4769347E0Ambrósio, Márcia Michelle de Queiroz96726539487http://buscatextual.cnpq.br/buscatextual/visualizacv.do?id=K4766737T4Batista, Fabiane Rabelo da Costa07132977784http://buscatextual.cnpq.br/buscatextual/visualizacv.do?id=K4739181P8Brito, Anna Luisa de Carvalho2019-06-17T12:04:46Z2019-06-17T12:04:52Z2019-06-172019-06-17T12:04:46Z2019-06-17T12:04:52Z2019-02-07info:eu-repo/semantics/publishedVersioninfo:eu-repo/semantics/masterThesisapplication/pdfCitação com autor incluído no texto: Brito (2019) Citação com autor não incluído no texto: (BRITO, 2019)https://repositorio.ufersa.edu.br/handle/prefix/1862porBRITO, Anna Luisa de Carvalho. Estudo genômico e proteômico do fitopatógeno Alternaria alternata na cultura do mamão. 2019. 59 f. Dissertação (Mestrado em Ambiente, Tecnologia e Sociedade), Universidade Federal Rural do Semi-Árido, Mossoró, 2019.CC-BY-SAinfo:eu-repo/semantics/openAccessreponame:Repositório Digital da Universidade Federal Rural do Semi-Árido (RDU)instname:Universidade Federal Rural do Semi-Árido (UFERSA)instacron:UFERSA2023-10-30T20:27:33Zoai:repositorio.ufersa.edu.br:prefix/1862Repositório Institucionalhttps://repositorio.ufersa.edu.br/PUBhttps://repositorio.ufersa.edu.br/server/oai/requestrepositorio@ufersa.edu.br || admrepositorio@ufersa.edu.bropendoar:2023-10-30T20:27:33Repositório Digital da Universidade Federal Rural do Semi-Árido (RDU) - Universidade Federal Rural do Semi-Árido (UFERSA)false |
dc.title.none.fl_str_mv |
Estudo genômico e proteômico do fitopatógeno Alternaria alternata na cultura do mamão |
title |
Estudo genômico e proteômico do fitopatógeno Alternaria alternata na cultura do mamão |
spellingShingle |
Estudo genômico e proteômico do fitopatógeno Alternaria alternata na cultura do mamão Brito, Anna Luisa de Carvalho Diagnóstico molecular Carica papaya Proteômica Molecular diagnosis Carica papaya Proteomics CNPQ::CIENCIAS AMBIENTAIS::MEIO AMBIENTE |
title_short |
Estudo genômico e proteômico do fitopatógeno Alternaria alternata na cultura do mamão |
title_full |
Estudo genômico e proteômico do fitopatógeno Alternaria alternata na cultura do mamão |
title_fullStr |
Estudo genômico e proteômico do fitopatógeno Alternaria alternata na cultura do mamão |
title_full_unstemmed |
Estudo genômico e proteômico do fitopatógeno Alternaria alternata na cultura do mamão |
title_sort |
Estudo genômico e proteômico do fitopatógeno Alternaria alternata na cultura do mamão |
author |
Brito, Anna Luisa de Carvalho |
author_facet |
Brito, Anna Luisa de Carvalho |
author_role |
author |
dc.contributor.none.fl_str_mv |
Jereissati, Emmanuel de Sousa 63418282334 http://buscatextual.cnpq.br/buscatextual/visualizacv.do?id=K4735133D5 Sales Junior, Rui 87634325449 http://buscatextual.cnpq.br/buscatextual/visualizacv.do?id=K4707958E1 Holanda, Ioná Santos Araújo 65180062500 http://buscatextual.cnpq.br/buscatextual/visualizacv.do?id=K4769347E0 Holanda, Ioná Santos Araújo 65180062500 http://buscatextual.cnpq.br/buscatextual/visualizacv.do?id=K4769347E0 Ambrósio, Márcia Michelle de Queiroz 96726539487 http://buscatextual.cnpq.br/buscatextual/visualizacv.do?id=K4766737T4 Batista, Fabiane Rabelo da Costa 07132977784 http://buscatextual.cnpq.br/buscatextual/visualizacv.do?id=K4739181P8 |
dc.contributor.author.fl_str_mv |
Brito, Anna Luisa de Carvalho |
dc.subject.por.fl_str_mv |
Diagnóstico molecular Carica papaya Proteômica Molecular diagnosis Carica papaya Proteomics CNPQ::CIENCIAS AMBIENTAIS::MEIO AMBIENTE |
topic |
Diagnóstico molecular Carica papaya Proteômica Molecular diagnosis Carica papaya Proteomics CNPQ::CIENCIAS AMBIENTAIS::MEIO AMBIENTE |
description |
Brazil is the second largest producer and third largest exporter of papaya. The intensive cultivation of papaya in fixed areas has favored fungal diseases capable of causing losses in the field and in the post-harvest period. Foliar lesions of fungal origin impair the photosynthetic capacity of the plant, leading to its death and facilitating the invasion into the fruit of pathogens causing rot during maturation, and being responsible for the more severe losses. In the culture of papaya, Alternaria alternata is capable of causing damage both in the fruit and in the leaf. The aim of the present work was to establish a rapid and sensitive diagnosis of A. alternata infection in papaya culture, and to investigate proteins related to such infection. In the present study, gene specific primers based on the Alt a 1 gene sequence (AaltDAlta1 - CGCATCCTGCCCTGTCA / AinfIAlta1 - GTTGGTAGCCTTGATGTTGAAGC) were used to make a rapid and safe molecular diagnosis of A. alternata infection in papaya producting areas of Rio Grande do Norte . In addition to genomic analysis, SDS-PAGE-based proteomic analysis was used to separate proteins extracted from control and inoculated groups of papaya seedlings of the Tainung and Feltrin varieties, in order to investigate differentially expressed proteins with potential to interfere in the pathology establishment process. The results of the genomic analysis showed that in 100% of the producting areas analyzed, the presence of the fungus A. alternata was found infecting papaya plants in the state of Rio Grande do Norte. In the evaluation of the symptoms after inoculation, it was noticed that the Feltrin variety possibly presents a greater resistance to the infection, due to having presented milder symptoms. With the proteomic evaluations, it was observed that in the Tainung variety the seedlings inoculated with A. alternata showed reduction of the expressed protein content. Among the inhibited proteins, RuBisCo protein, involved in plant photosynthetic metabolism, was identified. Thus, it is suggested that the inhibition of Rubisco protein may be involved in the mechanisms that lead to the appearance of symptoms related to pathogenesis |
publishDate |
2019 |
dc.date.none.fl_str_mv |
2019-06-17T12:04:46Z 2019-06-17T12:04:52Z 2019-06-17 2019-06-17T12:04:46Z 2019-06-17T12:04:52Z 2019-02-07 |
dc.type.status.fl_str_mv |
info:eu-repo/semantics/publishedVersion |
dc.type.driver.fl_str_mv |
info:eu-repo/semantics/masterThesis |
format |
masterThesis |
status_str |
publishedVersion |
dc.identifier.uri.fl_str_mv |
Citação com autor incluído no texto: Brito (2019) Citação com autor não incluído no texto: (BRITO, 2019) https://repositorio.ufersa.edu.br/handle/prefix/1862 |
identifier_str_mv |
Citação com autor incluído no texto: Brito (2019) Citação com autor não incluído no texto: (BRITO, 2019) |
url |
https://repositorio.ufersa.edu.br/handle/prefix/1862 |
dc.language.iso.fl_str_mv |
por |
language |
por |
dc.relation.none.fl_str_mv |
BRITO, Anna Luisa de Carvalho. Estudo genômico e proteômico do fitopatógeno Alternaria alternata na cultura do mamão. 2019. 59 f. Dissertação (Mestrado em Ambiente, Tecnologia e Sociedade), Universidade Federal Rural do Semi-Árido, Mossoró, 2019. |
dc.rights.driver.fl_str_mv |
CC-BY-SA info:eu-repo/semantics/openAccess |
rights_invalid_str_mv |
CC-BY-SA |
eu_rights_str_mv |
openAccess |
dc.format.none.fl_str_mv |
application/pdf |
dc.publisher.none.fl_str_mv |
Universidade Federal Rural do Semi-Árido Brasil Centro de Ciências Agrárias - CCA UFERSA Programa de Pós-Graduação em Ambiente, Tecnologia e Sociedade |
publisher.none.fl_str_mv |
Universidade Federal Rural do Semi-Árido Brasil Centro de Ciências Agrárias - CCA UFERSA Programa de Pós-Graduação em Ambiente, Tecnologia e Sociedade |
dc.source.none.fl_str_mv |
reponame:Repositório Digital da Universidade Federal Rural do Semi-Árido (RDU) instname:Universidade Federal Rural do Semi-Árido (UFERSA) instacron:UFERSA |
instname_str |
Universidade Federal Rural do Semi-Árido (UFERSA) |
instacron_str |
UFERSA |
institution |
UFERSA |
reponame_str |
Repositório Digital da Universidade Federal Rural do Semi-Árido (RDU) |
collection |
Repositório Digital da Universidade Federal Rural do Semi-Árido (RDU) |
repository.name.fl_str_mv |
Repositório Digital da Universidade Federal Rural do Semi-Árido (RDU) - Universidade Federal Rural do Semi-Árido (UFERSA) |
repository.mail.fl_str_mv |
repositorio@ufersa.edu.br || admrepositorio@ufersa.edu.br |
_version_ |
1809747458467561472 |