Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

• Autor(a) principal: Anunciação, Carlos Eduardo
• Data de Publicação: 2000
• Outros Autores: Filho, Spartaco Astolfi
• Tipo de documento: Artigo
• Idioma: eng
• Título da fonte: Pesquisa Agropecuária Brasileira (Online)
• Texto Completo: https://seer.sct.embrapa.br/index.php/pab/article/view/5989
• topic: breeding methods;molecular cloning; progeny testing; horses; identification; genetic polymorphism; métodos de melhoramento; clonagem molecular; teste de progênie; cavalos; identificação; polimorfismo genético

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 105-fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.