Incidência da doença de petri na videira ‘niagara rosada’ no estado de São Paulo - Brasil

Detalhes bibliográficos
Autor(a) principal: Ferreira, Ana Beatriz Monteiro
Data de Publicação: 2017
Outros Autores: Leite, Luís Garrigós, Harakava, Ricardo, Padovani, Carlos Roberto [UNESP], Bueno, César Júnior
Tipo de documento: Artigo
Idioma: por
Título da fonte: Repositório Institucional da UNESP
Texto Completo: http://dx.doi.org/10.1590/0100-5405/2154
http://hdl.handle.net/11449/179013
Resumo: The Petri disease caused mainly by Phaeomoniella chlamydospora and species of Phaeoacremonium is serious, complex, attacks young vine plants and is difficult to be controlled worldwide. In Brazil, São Paulo State is among the largest producers of ‘Niagara Rosada’ grapevine, and there is no official report of this disease in the state. Thus, the aims of the present study were to evaluate the incidence of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State and to compare methodologies to isolate the causal agents of this disease. Experimental design was completely randomized, testing three culture media (water-agar [WA], potato dextrose agar [PDA] and apple-green bait) with samples of diseased plants, disinfested or not, from nine sampling locality and eight replicates (Petri dish with the media and four fragments of the plants per sample). The number of colonies of causal agents per fragment per dish of each culture medium per locality was determined. Fungal isolates obtained by DNA extraction and sequencing of ITS-5.8S rDNA region [ITS1 TCCGTAGGTGAACCTGCGG and ITS4 TCCTCCGCTTATTGATATGC] and parts of the alpha elongase genes [EF1 ATGGGTAAGGARGACAAGAC and EF2 GGARGTACCAGTSATCATGTT] and beta tubulin genes [Bt2a GGTAACCAAATCGGTGCTGCTTTC and Bt2b ACCCTCAGTGTAGTGACCCTTGGC] were identified. Pathogenicity test was done with one isolate of Phaeomoniella spp. and one isolate of Phaeoacremonium spp. The disease incidence and severity (length of dark streaks in the vascular system) were evaluated. The municipalities Louveira B, Vinhedo, Jundiaí, Jarinu, Porto Feliz, Sao Miguel Arcanjo and Jales were the localities where the causal agents of the disease were present, demonstrating that the Petri disease occurs throughout São Paulo State. The most prevalent species of Phaeoacremonium was P. minimum (= P. aleophilum). Besides P. minimum, the species P. venezuelense was detected only in the municipality of Jales. P. chlamydospora was the only species identified within this genus. Isolation percentage was higher for P. chlamydospora than for Phaeoacremonium spp. The causal agents of the disease must be isolated by removing fragments of the vascular system from the collar region of symptomatic plants, followed by surface disinfection and plating of fragments in PDA culture medium. Incubation in BOD should be at 23ºC for up to 21 days. The apple-green bait method followed by culturing in PDA did not allow isolation of any of the causal agents of the disease. All inoculated plants developed external symptoms and internally the average length of dark streaks was 7.9 cm for P. chlamydospora and 5.2 cm for P. minimum. Control plants remained healthy. Fungi were re-isolated from diseased plants, completing the Koch’s postulates, thus making official the record of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State, Brazil.
id UNSP_fb31a36c2af5ea8723c6e6104918ab8a
oai_identifier_str oai:repositorio.unesp.br:11449/179013
network_acronym_str UNSP
network_name_str Repositório Institucional da UNESP
repository_id_str 2946
spelling Incidência da doença de petri na videira ‘niagara rosada’ no estado de São Paulo - BrasilIncidence of petri disease in ‘niagara rosada’ grapevine in São Paulo state - BrazilDeclinePhaeoacremonium aleophiliumPhaeoacremonium minimumPhaeomoniella chlamydosporaThe Petri disease caused mainly by Phaeomoniella chlamydospora and species of Phaeoacremonium is serious, complex, attacks young vine plants and is difficult to be controlled worldwide. In Brazil, São Paulo State is among the largest producers of ‘Niagara Rosada’ grapevine, and there is no official report of this disease in the state. Thus, the aims of the present study were to evaluate the incidence of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State and to compare methodologies to isolate the causal agents of this disease. Experimental design was completely randomized, testing three culture media (water-agar [WA], potato dextrose agar [PDA] and apple-green bait) with samples of diseased plants, disinfested or not, from nine sampling locality and eight replicates (Petri dish with the media and four fragments of the plants per sample). The number of colonies of causal agents per fragment per dish of each culture medium per locality was determined. Fungal isolates obtained by DNA extraction and sequencing of ITS-5.8S rDNA region [ITS1 TCCGTAGGTGAACCTGCGG and ITS4 TCCTCCGCTTATTGATATGC] and parts of the alpha elongase genes [EF1 ATGGGTAAGGARGACAAGAC and EF2 GGARGTACCAGTSATCATGTT] and beta tubulin genes [Bt2a GGTAACCAAATCGGTGCTGCTTTC and Bt2b ACCCTCAGTGTAGTGACCCTTGGC] were identified. Pathogenicity test was done with one isolate of Phaeomoniella spp. and one isolate of Phaeoacremonium spp. The disease incidence and severity (length of dark streaks in the vascular system) were evaluated. The municipalities Louveira B, Vinhedo, Jundiaí, Jarinu, Porto Feliz, Sao Miguel Arcanjo and Jales were the localities where the causal agents of the disease were present, demonstrating that the Petri disease occurs throughout São Paulo State. The most prevalent species of Phaeoacremonium was P. minimum (= P. aleophilum). Besides P. minimum, the species P. venezuelense was detected only in the municipality of Jales. P. chlamydospora was the only species identified within this genus. Isolation percentage was higher for P. chlamydospora than for Phaeoacremonium spp. The causal agents of the disease must be isolated by removing fragments of the vascular system from the collar region of symptomatic plants, followed by surface disinfection and plating of fragments in PDA culture medium. Incubation in BOD should be at 23ºC for up to 21 days. The apple-green bait method followed by culturing in PDA did not allow isolation of any of the causal agents of the disease. All inoculated plants developed external symptoms and internally the average length of dark streaks was 7.9 cm for P. chlamydospora and 5.2 cm for P. minimum. Control plants remained healthy. Fungi were re-isolated from diseased plants, completing the Koch’s postulates, thus making official the record of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State, Brazil.Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)Instituto Biológico APTA, Alameda dos Vidoeiros, n. 1097, Bairro GramadoBolsista CAPES (Parte da dissertação de mestrado), Avenida Conselheiro Rodrigues Alves, 1252Instituto Biológico APTA, Avenida Conselheiro Rodrigues Alves, 1252Instituto de Biociências UNESPInstituto de Biociências UNESPAPTABolsista CAPES (Parte da dissertação de mestrado)Universidade Estadual Paulista (Unesp)Ferreira, Ana Beatriz MonteiroLeite, Luís GarrigósHarakava, RicardoPadovani, Carlos Roberto [UNESP]Bueno, César Júnior2018-12-11T17:33:08Z2018-12-11T17:33:08Z2017-04-01info:eu-repo/semantics/publishedVersioninfo:eu-repo/semantics/article124-131application/pdfhttp://dx.doi.org/10.1590/0100-5405/2154Summa Phytopathologica, v. 43, n. 2, p. 124-131, 2017.0100-5405http://hdl.handle.net/11449/17901310.1590/0100-5405/2154S0100-540520170002001242-s2.0-85022098680S0100-54052017000200124.pdfScopusreponame:Repositório Institucional da UNESPinstname:Universidade Estadual Paulista (UNESP)instacron:UNESPporSumma Phytopathologica0,258info:eu-repo/semantics/openAccess2024-10-08T14:59:01Zoai:repositorio.unesp.br:11449/179013Repositório InstitucionalPUBhttp://repositorio.unesp.br/oai/requestrepositoriounesp@unesp.bropendoar:29462024-10-08T14:59:01Repositório Institucional da UNESP - Universidade Estadual Paulista (UNESP)false
dc.title.none.fl_str_mv Incidência da doença de petri na videira ‘niagara rosada’ no estado de São Paulo - Brasil
Incidence of petri disease in ‘niagara rosada’ grapevine in São Paulo state - Brazil
title Incidência da doença de petri na videira ‘niagara rosada’ no estado de São Paulo - Brasil
spellingShingle Incidência da doença de petri na videira ‘niagara rosada’ no estado de São Paulo - Brasil
Ferreira, Ana Beatriz Monteiro
Decline
Phaeoacremonium aleophilium
Phaeoacremonium minimum
Phaeomoniella chlamydospora
title_short Incidência da doença de petri na videira ‘niagara rosada’ no estado de São Paulo - Brasil
title_full Incidência da doença de petri na videira ‘niagara rosada’ no estado de São Paulo - Brasil
title_fullStr Incidência da doença de petri na videira ‘niagara rosada’ no estado de São Paulo - Brasil
title_full_unstemmed Incidência da doença de petri na videira ‘niagara rosada’ no estado de São Paulo - Brasil
title_sort Incidência da doença de petri na videira ‘niagara rosada’ no estado de São Paulo - Brasil
author Ferreira, Ana Beatriz Monteiro
author_facet Ferreira, Ana Beatriz Monteiro
Leite, Luís Garrigós
Harakava, Ricardo
Padovani, Carlos Roberto [UNESP]
Bueno, César Júnior
author_role author
author2 Leite, Luís Garrigós
Harakava, Ricardo
Padovani, Carlos Roberto [UNESP]
Bueno, César Júnior
author2_role author
author
author
author
dc.contributor.none.fl_str_mv APTA
Bolsista CAPES (Parte da dissertação de mestrado)
Universidade Estadual Paulista (Unesp)
dc.contributor.author.fl_str_mv Ferreira, Ana Beatriz Monteiro
Leite, Luís Garrigós
Harakava, Ricardo
Padovani, Carlos Roberto [UNESP]
Bueno, César Júnior
dc.subject.por.fl_str_mv Decline
Phaeoacremonium aleophilium
Phaeoacremonium minimum
Phaeomoniella chlamydospora
topic Decline
Phaeoacremonium aleophilium
Phaeoacremonium minimum
Phaeomoniella chlamydospora
description The Petri disease caused mainly by Phaeomoniella chlamydospora and species of Phaeoacremonium is serious, complex, attacks young vine plants and is difficult to be controlled worldwide. In Brazil, São Paulo State is among the largest producers of ‘Niagara Rosada’ grapevine, and there is no official report of this disease in the state. Thus, the aims of the present study were to evaluate the incidence of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State and to compare methodologies to isolate the causal agents of this disease. Experimental design was completely randomized, testing three culture media (water-agar [WA], potato dextrose agar [PDA] and apple-green bait) with samples of diseased plants, disinfested or not, from nine sampling locality and eight replicates (Petri dish with the media and four fragments of the plants per sample). The number of colonies of causal agents per fragment per dish of each culture medium per locality was determined. Fungal isolates obtained by DNA extraction and sequencing of ITS-5.8S rDNA region [ITS1 TCCGTAGGTGAACCTGCGG and ITS4 TCCTCCGCTTATTGATATGC] and parts of the alpha elongase genes [EF1 ATGGGTAAGGARGACAAGAC and EF2 GGARGTACCAGTSATCATGTT] and beta tubulin genes [Bt2a GGTAACCAAATCGGTGCTGCTTTC and Bt2b ACCCTCAGTGTAGTGACCCTTGGC] were identified. Pathogenicity test was done with one isolate of Phaeomoniella spp. and one isolate of Phaeoacremonium spp. The disease incidence and severity (length of dark streaks in the vascular system) were evaluated. The municipalities Louveira B, Vinhedo, Jundiaí, Jarinu, Porto Feliz, Sao Miguel Arcanjo and Jales were the localities where the causal agents of the disease were present, demonstrating that the Petri disease occurs throughout São Paulo State. The most prevalent species of Phaeoacremonium was P. minimum (= P. aleophilum). Besides P. minimum, the species P. venezuelense was detected only in the municipality of Jales. P. chlamydospora was the only species identified within this genus. Isolation percentage was higher for P. chlamydospora than for Phaeoacremonium spp. The causal agents of the disease must be isolated by removing fragments of the vascular system from the collar region of symptomatic plants, followed by surface disinfection and plating of fragments in PDA culture medium. Incubation in BOD should be at 23ºC for up to 21 days. The apple-green bait method followed by culturing in PDA did not allow isolation of any of the causal agents of the disease. All inoculated plants developed external symptoms and internally the average length of dark streaks was 7.9 cm for P. chlamydospora and 5.2 cm for P. minimum. Control plants remained healthy. Fungi were re-isolated from diseased plants, completing the Koch’s postulates, thus making official the record of Petri disease in ‘Niagara Rosada’ grapevine in São Paulo State, Brazil.
publishDate 2017
dc.date.none.fl_str_mv 2017-04-01
2018-12-11T17:33:08Z
2018-12-11T17:33:08Z
dc.type.status.fl_str_mv info:eu-repo/semantics/publishedVersion
dc.type.driver.fl_str_mv info:eu-repo/semantics/article
format article
status_str publishedVersion
dc.identifier.uri.fl_str_mv http://dx.doi.org/10.1590/0100-5405/2154
Summa Phytopathologica, v. 43, n. 2, p. 124-131, 2017.
0100-5405
http://hdl.handle.net/11449/179013
10.1590/0100-5405/2154
S0100-54052017000200124
2-s2.0-85022098680
S0100-54052017000200124.pdf
url http://dx.doi.org/10.1590/0100-5405/2154
http://hdl.handle.net/11449/179013
identifier_str_mv Summa Phytopathologica, v. 43, n. 2, p. 124-131, 2017.
0100-5405
10.1590/0100-5405/2154
S0100-54052017000200124
2-s2.0-85022098680
S0100-54052017000200124.pdf
dc.language.iso.fl_str_mv por
language por
dc.relation.none.fl_str_mv Summa Phytopathologica
0,258
dc.rights.driver.fl_str_mv info:eu-repo/semantics/openAccess
eu_rights_str_mv openAccess
dc.format.none.fl_str_mv 124-131
application/pdf
dc.source.none.fl_str_mv Scopus
reponame:Repositório Institucional da UNESP
instname:Universidade Estadual Paulista (UNESP)
instacron:UNESP
instname_str Universidade Estadual Paulista (UNESP)
instacron_str UNESP
institution UNESP
reponame_str Repositório Institucional da UNESP
collection Repositório Institucional da UNESP
repository.name.fl_str_mv Repositório Institucional da UNESP - Universidade Estadual Paulista (UNESP)
repository.mail.fl_str_mv repositoriounesp@unesp.br
_version_ 1824435105812185088